- Grew up plasmid (pSport1-Sfi-MTMR7)
- PCR hMTMR7 sequence including BamH1 and Xho1
sites.
Primers:
Forward: 5’- t aGG ATC CCC atggagcacatccgcacg -3’ name=hMTMR7for.
length: 28
Tm: 66ºC
%GC: 61
Reverse: 5’- atCTCGAG tcaggcagtgagaaacacggcttc
-3’ name=hMTMR7rev.
length: 32
Tm: 66ºC
%GC: 52
- After PCR, run product and recover 2 kb band. Poly A DNA and ligate into pCR4-Topo
- Send for sequencing- Subcloned into:
Prey pACT2…………………...with BamH1 and
Xho1 (pACT2-hMTMR7)
Bait pFBT9………………….…with BamH1
and Sal1 (pFBT9-hMTMR7)
-For co-IP/co-IF:
Digest: pCR-Topo-hMTMR7 with BamH1 and Xho1
pCMV-HA with Bgl II and Xho1
pEGFP-C2 with Bgl II and Sal1