hMTMR13-sbf2 (PCR from Human Liver cDNA):


- PCR hMTMR13 sequence including XhoI sites in both extremes (check orientation).

Primers:
Forward: 5’- t aCT CGA GCC ATG GCC CGG CTG GCT GAC TAC TTC-3’ name=MTMR13for. (4.0 mg/ml)

length: 34
Tm: 70ºC
%GC: 62

Reverse: 5’- gaCTCGAG TCAGGCATCAGAGATACAACTCTG-3’ name=MTMR13rev. (3.8 mg/ml)


length: 32
Tm: 64ºC
%GC: 50

- Nested Strategy:

Nested primers: Forward: 5’- GCTGCAGGGAAAATGCTGAGCCCTC-3’ (25, 63, 60%)
Reverse: 5’- CTTCTGCGTGGGTTGACCATGG -3’ (22, 59, 59%)

- After PCR, run product and recover 5.57 Kb band. Ligate into pCR4-Blutn-TOPO


- Send for sequencing


- Subcloned into:
Prey pACT2…………………...with Xho1 (pACT2-hMTMR13)
Bait pFBT9………………….…with Sal1 (pFBT9-hMTMR13)

!!it did not work!!

 

- Digest:
pCR-Topo-hMTMR13 with Xho1
pCMV-HA with Xho1 (and treated with Antartic)
pEGFP-C1 with Xho1 (and treated with Antartic)

!!it did not work!!

 

- Subcloning in fragments. After sequencing PCR product, there was a gap in the seq.

!!it did not work!!