- PCR hMTMR13 sequence including XhoI sites in both extremes (check orientation).
Primers:
Forward: 5’- t aCT CGA GCC ATG GCC CGG CTG GCT GAC TAC TTC-3’ name=MTMR13for.
(4.0 mg/ml)
length: 34
Tm: 70ºC
%GC: 62
Reverse: 5’- gaCTCGAG TCAGGCATCAGAGATACAACTCTG-3’ name=MTMR13rev. (3.8 mg/ml)
length: 32
Tm: 64ºC
%GC: 50
- Nested Strategy:
Nested primers: Forward: 5’- GCTGCAGGGAAAATGCTGAGCCCTC-3’ (25,
63, 60%)
Reverse: 5’- CTTCTGCGTGGGTTGACCATGG -3’ (22, 59, 59%)
- After PCR, run product and recover 5.57 Kb band. Ligate into pCR4-Blutn-TOPO
- Send for sequencing
- Subcloned into:
Prey pACT2…………………...with Xho1 (pACT2-hMTMR13)
Bait pFBT9………………….…with Sal1
(pFBT9-hMTMR13)
!!it did not work!!
- Digest:
pCR-Topo-hMTMR13 with Xho1
pCMV-HA with Xho1 (and treated with Antartic)
pEGFP-C1 with Xho1 (and treated with Antartic)
!!it did not work!!
- Subcloning in fragments. After sequencing PCR product, there was a gap in the seq.
!!it did not work!!