- Grew up plasmid (pSport1-MTMR10)
- PCR hMTMR10 sequence including Xho1 and Xho1 sites (check orientation).
Primers:
Forward: 5’- t aCT CGA GAA atgttctccctcaagccgcc-3’ name=newhMTMR10for.
length: 30
Tm: 64ºC
%GC: 53
Reverse: 5’- gcCTCGAG ttagtcttcatttgctaatgtctc -3’ name=newhMTMR10rev.
length: 32
Tm: 62ºC
%GC: 44
- After PCR, run product and recover 2.3 Kb band. Ligate into pCR4-Blunt-TOPO
- Send for sequencing
- Subcloned into:
Prey pACT2…………………...with Xho1 (pACT2-hMTMR10)
Bait pFBT9………………….…with Sal1
(pFBT9-hMTMR10)
- For co-IP/IF
Digest:
pCR-Topo-hMTMR10 with Xho1
pCMV-HA with Xho1 (and treated with Antartic enzime)
pEGFP-C1 with Xho1 (and treated with Antartic enzime)